header

genetic-algorithms.com

 

Inspect guest63_0_1_7

Parents

Mother

Image 01

guest63_0_0_16

Genome: CGTCCGCAATCCAGGCATGGCTTCCCGTCT

Father

Image 01

guest63_0_0_17

Genome: CTATAGCGGCGCACATAGGCTGAGGACGGC

guest63_0_1_7

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 1
  • Total Fitness: 9
  • No. Votes: 1
  • Avg. Fitness 9
  • Created: 05/19/2019
  • Genome: CGTCCGCAATCCAGGCAGGCATTCCTGTCT
  • Function:

    log(divide(sum(numbers("xyx") if numbers('rep') > numbers("yyy") else tan(numbers("xyx")), tan(numbers("xyx"))), numbers('rep') if numbers("xyx") > numbers("yyy") else tan(numbers("xyx"))), sum(tan(numbers("xyx")) if numbers("yyy") > numbers("xyx") else numbers('rep'), tan(numbers("xyx"))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_2_22

Image 01

Genome: CATCGCCCGCAATCCAGGCAGGCTGGCCTGTCT

guest63_0_2_12

Image 01

Genome: CGTCGGCAATCCAGGCAAATCAACCAGTCT

guest63_0_2_11

Image 01

Genome: GGGCGTCCACAATCCAGCCAGGCATTCCTGTCT

guest63_0_2_10

Image 01

Genome: CATCCGCAACCTGAGGATGCGTTCCTGTTT

guest63_0_2_24

Image 01

Genome: CCAGTGGAGTCTTGACCTATCTTTTGTTAA