header

genetic-algorithms.com

 

Inspect guest63_0_1_15

Parents

Mother

Image 01

guest63_0_0_26

Genome: GAGTGGCTCTGATCTACGGCGCTCAACCCA

Father

Image 01

guest63_0_0_16

Genome: CGTCCGCAATCCAGGCATGGCTTCCCGTCT

guest63_0_1_15

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 1
  • Total Fitness: 27
  • No. Votes: 3
  • Avg. Fitness 9
  • Created: 05/19/2019
  • Genome: GAGGAGTGGTTCTAATCTCATGGCCTCAACCCA
  • Function:

    numbers("xxy") if numbers('xry') > numbers('rep') else numbers("yxx") if numbers('rep') if numbers("yxx") if numbers("xxy") > numbers('rep') else numbers('xry') > numbers('xry') else numbers("yxx") if numbers('rep') if numbers("yxx") > numbers('xry') else numbers("xxy") > numbers('xry') else numbers("yxx") > numbers("yxx") else numbers('rep') if numbers('xry') > numbers("yxx") else numbers('xry') if numbers('rep') > numbers("yxx") else numbers("xxy") if numbers('xry') if numbers("xxy") > numbers('rep') else numbers("yxx") > numbers("xxy") if numbers('xry') > numbers('rep') else numbers("yxx") if numbers("yxx") > numbers('xry') else numbers('rep') else numbers("xxy") if numbers('xry') > numbers('rep') else numbers("yxx") if numbers("yxx") > numbers('xry') else numbers('rep') if numbers("yxx") > numbers('xry') if numbers("yxx") > numbers("xxy") else numbers('rep') else numbers('xry') if numbers("yxx") if numbers('rep') if numbers('xry') > numbers("yxx") else numbers("xxy") if numbers("yxx") > numbers('rep') else numbers('xry') if numbers("xxy") if numbers('rep') > numbers("yxx") else numbers('xry') > numbers('xry') else numbers("yxx") > numbers("yxx") if numbers('rep') > numbers('xry') else numbers("xxy") else numbers("yxx") if numbers("xxy") > numbers('xry') else numbers('rep') if numbers('rep') > numbers("yxx") else numbers('xry') > numbers('xry') if numbers('rep') > numbers("yxx") else numbers("yxx") if numbers('xry') > numbers("xxy") else numbers('rep') else numbers("yxx") if numbers('rep') if numbers("xxy") if numbers("yxx") > numbers('rep') else numbers('xry') > numbers("yxx") else numbers('xry') > numbers('xry') else numbers('xry') if numbers("xxy") > numbers('rep') else numbers("yxx")

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_2_22

Image 01

Genome: CATCGCCCGCAATCCAGGCAGGCTGGCCTGTCT

guest63_0_2_4

Image 01

Genome: ACAGCACTTTTGTAGTTGGGGTCTAGCCTCATCTTG