header

genetic-algorithms.com

 

Inspect guest63_0_2_22

Parents

Mother

Image 01

guest63_0_1_7

Genome: CGTCCGCAATCCAGGCAGGCATTCCTGTCT

Father

Image 01

guest63_0_1_15

Genome: GAGGAGTGGTTCTAATCTCATGGCCTCAACCCA

guest63_0_2_22

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 2
  • Total Fitness: 39
  • No. Votes: 4
  • Avg. Fitness 9.8
  • Created: 05/19/2019
  • Genome: CATCGCCCGCAATCCAGGCAGGCTGGCCTGTCT
  • Function:

    minus(round(divide(sum(tan(numbers("xyx")) if numbers('xyy') > numbers("xyx") else numbers('xry'), tan(numbers("xyx"))), numbers("xyx") if numbers('xry') > tan(numbers("xyx")) else numbers('xyy')), sum(numbers('xry') if numbers("xyx") > numbers('xyy') else tan(numbers("xyx")), tan(numbers("xyx")))), divide(sum(numbers('xry') if numbers("xyx") > tan(numbers("xyx")) else numbers('xyy'), tan(numbers("xyx"))), numbers('xyy') if numbers("xyx") > numbers('xry') else tan(numbers("xyx"))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_3_20

Image 01

Genome: CATCGCCCGTTGTCCAGGCAGGCTGCCCTGTCG

guest63_0_3_19

Image 01

Genome: CATATTCCGCGGGATAGCCACTGTCCGTCT

guest63_0_3_17

Image 01

Genome: GCTAATCGGCTCTGATCTACGTCGCTCGTTTTA

guest63_0_3_7

Image 01

Genome: TGCAACTCGCCCTGATCTGCATCGCTTGGCTTT

guest63_0_3_2

Image 01

Genome: CCAGTGTAGCAATCCAGGCTGGCTGGTTAA