header

genetic-algorithms.com

 

Inspect guest63_0_2_1

Parents

Mother

Image 01

guest63_0_1_23

Genome: CGTGGTGCGAACGGAAATGGCTTCCCGTCT

Father

Image 01

guest63_0_1_11

Genome: GATATCCCGAAAGATAGCCGCTGTGTCACT

guest63_0_2_1

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 2
  • Total Fitness: 19
  • No. Votes: 2
  • Avg. Fitness 9.5
  • Created: 05/19/2019
  • Genome: CATATCCCGAAGGATAGCCGCTGTCCGTCT
  • Function:

    minus(band pass(divide(invert(numbers('yxy') if numbers('xry') > numbers('xry') else numbers('ryy')), numbers('xry') if numbers('yxy') > numbers('xry') else numbers('ryy'))), divide(invert(numbers('ryy') if numbers('xry') > numbers('yxy') else numbers('xry')), numbers('xry') if numbers('xry') > numbers('ryy') else numbers('yxy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_3_19

Image 01

Genome: CATATTCCGCGGGATAGCCACTGTCCGTCT