header

genetic-algorithms.com

 

Inspect guest63_0_3_19

Parents

Mother

Image 01

guest63_0_2_1

Genome: CATATCCCGAAGGATAGCCGCTGTCCGTCT

Father

Image 01

guest63_0_2_22

Genome: CATCGCCCGCAATCCAGGCAGGCTGGCCTGTCT

guest63_0_3_19

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 3
  • Total Fitness: 10
  • No. Votes: 1
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: CATATTCCGCGGGATAGCCACTGTCCGTCT
  • Function:

    minus(gradient[0](divide(exp(numbers('xry') if numbers('ryy') > numbers("xxy") else numbers('yxy'), numbers('xry')), numbers('xry') if numbers("xxy") > numbers('yxy') else numbers('ryy'))), divide(exp(numbers('xry') if numbers("xxy") > numbers('yxy') else numbers('ryy'), numbers('xry')), numbers('xry') if numbers("xxy") > numbers('yxy') else numbers('ryy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_4_26

Image 01

Genome: GCGAACGGCCGGGATAGCCACTGTCCGTCT

guest63_0_4_16

Image 01

Genome: GATATTCCGCGGGGTAGCTTCTCCTATTCT

guest63_0_4_6

Image 01

Genome: CATTTATAGCCATCCAGCCACTGTCCGTCA

guest63_0_4_23

Image 01

Genome: CACTGGTTGTCTAAGTTGCCCTTCTCCTATTTT