header

genetic-algorithms.com

 

Inspect guest63_0_2_15

Parents

Mother

Image 01

guest63_0_1_27

Genome: TGGTTGTCTATGTCTCCATTTCCCTACTTT

Father

Image 01

guest63_0_1_22

Genome: GCACTTTTGTAGTTGGGGACTAAGAAGTTCTAG

guest63_0_2_15

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 2
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 05/19/2019
  • Genome: TGGTTGTCTAAGGTGCCCTTTCCCTATTTT
  • Function:

    invert(numbers('rrr') if numbers('yyx') > numbers("yxx") else numbers('yyx')) if numbers('yyx') if numbers("yxx") > numbers('yyx') else numbers('rrr') > invert(numbers('yyx') if numbers("yxx") > numbers('rrr') else numbers('yyx')) if numbers('rrr') if numbers('yyx') > numbers('yyx') else numbers("yxx") > numbers('rrr') else numbers('yyx') else numbers('rrr') if numbers('yyx') > numbers("yxx") else numbers('yyx') if numbers('yyx') if invert(numbers("yxx") if numbers('yyx') > numbers('rrr') else numbers('yyx')) > numbers('rrr') else numbers('yyx') if numbers('yyx') > numbers("yxx") else numbers('rrr') > numbers('yyx') else invert(numbers('yyx') if numbers('rrr') > numbers("yxx") else numbers('yyx'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_3_14

Image 01

Genome: TGGTTGTCTAAGGTGCCCTTTACCTCTTTT

guest63_0_3_18

Image 01

Genome: TGGTTGTCTAAGGTGCCCTTCTCCTATTTT