header

genetic-algorithms.com

 

Inspect guest63_0_3_18

Parents

Mother

Image 01

guest63_0_2_15

Genome: TGGTTGTCTAAGGTGCCCTTTCCCTATTTT

Father

Image 01

guest63_0_2_19

Genome: CGTCGACTGGTGGCCCATCGCTTCCCCTCT

guest63_0_3_18

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 3
  • Total Fitness: 6
  • No. Votes: 1
  • Avg. Fitness 6
  • Created: 05/19/2019
  • Genome: TGGTTGTCTAAGGTGCCCTTCTCCTATTTT
  • Function:

    invert(numbers('rep') if numbers('yyx') > numbers('yyx') else numbers("yxx")) if numbers('yyx') if numbers("yxx") > numbers('yyx') else numbers('rep') if numbers("yxx") if numbers('rep') > numbers('yyx') else numbers('yyx') if invert(numbers('yyx') if numbers('rep') > numbers("yxx") else numbers('yyx')) > numbers('rep') else numbers('yyx') > numbers('yyx') else invert(numbers('yyx') if numbers('yyx') > numbers("yxx") else numbers('rep')) > numbers('rep') if invert(numbers("yxx") if numbers('yyx') > numbers('yyx') else numbers('rep')) > numbers('yyx') else numbers('yyx') if numbers('rep') > numbers('yyx') else numbers("yxx") else numbers("yxx") if numbers('yyx') > numbers('yyx') else numbers('rep')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_4_23

Image 01

Genome: CACTGGTTGTCTAAGTTGCCCTTCTCCTATTTT

guest63_0_4_18

Image 01

Genome: TGGTTGTCTAAGCAGTAATCACATCTTTTT

guest63_0_4_2

Image 01

Genome: AATTGGTTGTCATGGCCTTACCTGTCCGTTTTT

guest63_0_4_16

Image 01

Genome: GATATTCCGCGGGGTAGCTTCTCCTATTCT

guest63_0_4_15

Image 01

Genome: AGGTTCTCTAATGTGCACTTCTCTGTCAGG