header

genetic-algorithms.com

 

Inspect guest63_0_3_20

Parents

Mother

Image 01

guest63_0_2_22

Genome: CATCGCCCGCAATCCAGGCAGGCTGGCCTGTCT

Father

Image 01

guest63_0_2_2

Genome: TCGCTTTGCTTGTGGGACGTCACTGAGTGTGAG

guest63_0_3_20

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 3
  • Total Fitness: 1
  • No. Votes: 1
  • Avg. Fitness 1
  • Created: 05/19/2019
  • Genome: CATCGCCCGTTGTCCAGGCAGGCTGCCCTGTCG
  • Function:

    minus(round(divide(tan(numbers("xyx")) if numbers("xyx") > numbers('xyy') else tan(numbers("xyx")) if numbers('xyy') > numbers('yyx') else numbers("xyx"), tan(numbers("xyx")) if numbers('xyy') > numbers('yyx') else numbers("xyx")), tan(numbers("xyx")) if numbers("xyx") > numbers('xyy') if numbers("xyx") > numbers('yyx') else tan(numbers("xyx")) else numbers('xyy')), divide(tan(numbers("xyx")) if numbers('xyy') > numbers("xyx") else numbers('yyx') if numbers("xyx") > tan(numbers("xyx")) else numbers('xyy'), tan(numbers("xyx")) if numbers('xyy') > numbers("xyx") else numbers('yyx')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_3_20 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!