header

genetic-algorithms.com

 

Inspect guest63_0_4_18

Parents

Mother

Image 01

guest63_0_3_18

Genome: TGGTTGTCTAAGGTGCCCTTCTCCTATTTT

Father

Image 01

guest63_0_3_13

Genome: GCGAACGGCCTGCAGTAATCACATCTATACACT

guest63_0_4_18

Image 01

  • Creator: guest63
  • Population: 0
  • Generation: 4
  • Total Fitness: 7
  • No. Votes: 1
  • Avg. Fitness 7
  • Created: 05/19/2019
  • Genome: TGGTTGTCTAAGCAGTAATCACATCTTTTT
  • Function:

    invert(minus(numbers("xxx"), numbers("yyy"))) if minus(numbers("xxx"), numbers("yyy")) > minus(numbers("xxx"), numbers("yyy")) if invert(minus(numbers("xxx"), numbers("yyy"))) > numbers("yyy") else numbers("xxx") else minus(numbers("xxx"), numbers("yyy")) if numbers("xxx") if minus(numbers("xxx"), numbers("yyy")) > numbers("yyy") else invert(minus(numbers("xxx"), numbers("yyy"))) > numbers("xxx") else invert(minus(numbers("xxx"), numbers("yyy")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest63_0_5_7

Image 01

Genome: TGGATGTTCGGATGGTAATCACGTCTATTT

guest63_0_5_12

Image 01

Genome: TTCTGGTTGTCTAAGCAGTTATCACATCTTTTT

guest63_0_5_15

Image 01

Genome: TCATGGTTGTACCGGGCTAGCCACTGTCTTTTT

guest63_0_5_24

Image 01

Genome: TGGTTGTTTAAGCCTTAGCCACCTCTTTTT

guest63_0_5_17

Image 01

Genome: TGGATCTGGTAGCAAACCGCGGGCCACTCG