• Creator: guest18529
• Population: 0
• Generation: 6
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 02/18/2026
• Genome: GACACCAGCACGCCCAACAACTCGTCAATTCCG
• Function:

  product(square(numbers("xxy")), numbers("xxy")) if 10 *(cos(100 *(product(square(numbers("xxy")), numbers("xxy"))))) > cos(100 *(product(square(numbers("xxy")), numbers("xxy")))) else 100 *(product(square(numbers("xxy")), numbers("xxy")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.