• Creator: guest18529
• Population: 0
• Generation: 7
• Total Fitness: 2
• No. Votes: 1
• Avg. Fitness 2
• Created: 02/18/2026
• Genome: CACACCAGCCCGCCCAACAACTCGTCAATTCCG
• Function:

  sum(10 *(cos(divide(product(square(numbers("xxy")), numbers("xxy")), square(numbers("xxy"))))), cos(divide(product(square(numbers("xxy")), numbers("xxy")), square(numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.