• Creator: guest18529
• Population: 0
• Generation: 8
• Total Fitness: 9
• No. Votes: 1
• Avg. Fitness 9
• Created: 02/18/2026
• Genome: AGCGTCTCAAGCACGACCCATAACTGGCCAGGATGG
• Function:

  cos(10 *(numbers("yxx")) if cos(100 *(10 *(numbers("yxx")))) > 100 *(10 *(numbers("yxx"))) else numbers("yxx") if 10 *(numbers("yxx")) > 100 *(10 *(numbers("yxx"))) else cos(100 *(10 *(numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.