• Creator: guest18529
• Population: 0
• Generation: 7
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 02/18/2026
• Genome: GGAACAAGCACGACCAACAACTCGACGTTTGCG
• Function:

  100 *(10 *(square(numbers("xxy")))) if gradient[2](cos(100 *(10 *(square(numbers("xxy")))))) > 10 *(square(numbers("xxy"))) else cos(100 *(10 *(square(numbers("xxy")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.