• Creator: guest18529
• Population: 0
• Generation: 8
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 02/18/2026
• Genome: TTGTCCAGCACGACCAACAACTCGACGTTC
• Function:

  numbers("xxy") if 10 *(numbers("xxy")) > cos(100 *(10 *(numbers("xxy")))) else 100 *(10 *(numbers("xxy"))) if cos(100 *(10 *(numbers("xxy")))) > 100 *(10 *(numbers("xxy"))) else 10 *(numbers("xxy"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.