header

genetic-algorithms.com

 

Inspect sina12345_0_1_6

Parents

Mother

Image 01

sina12345_0_0_1

Genome: TATTGGGTGTCCCGCACTTGCCGTTAGTCG

Father

Image 01

sina12345_0_0_20

Genome: CTACTAAGGGCTGCAACACTGTCATTCTGG

sina12345_0_1_6

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 1
  • Total Fitness: 3
  • No. Votes: 1
  • Avg. Fitness 3
  • Created: 05/19/2019
  • Genome: TAATATTGGATGGCCCGCACTTGCCGTTAGTCG
  • Function:

    numbers('ryy') if numbers('xry') > round(numbers('xyy'), numbers('xry')) else numbers('xyy') if round(numbers('xyy'), numbers('xry')) > sqrt(numbers('xyy') if round(numbers('xyy'), numbers('xry')) > numbers('ryy') else numbers('xry')) else sqrt(numbers('ryy') if numbers('xry') > round(numbers('xyy'), numbers('xry')) else numbers('xyy')) if round(numbers('xyy'), numbers('xry')) > numbers('xyy') else numbers('xyy') if numbers('xry') > round(numbers('xyy'), numbers('xry')) else numbers('ryy') if numbers('ryy') if round(numbers('xyy'), numbers('xry')) > numbers('xyy') else numbers('xry') > numbers('xyy') if numbers('xyy') if numbers('ryy') > numbers('xry') else round(numbers('xyy'), numbers('xry')) > sqrt(round(numbers('xyy'), numbers('xry')) if numbers('xyy') > numbers('xry') else numbers('ryy')) else round(numbers('xyy'), numbers('xry')) else sqrt(numbers('ryy') if numbers('xry') > round(numbers('xyy'), numbers('xry')) else numbers('xyy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_25

Image 01

Genome: ATGCGGACTAGGATGGCCCTGAACACTGTGACC

sina12345_0_2_21

Image 01

Genome: TGTGGATGCTGGATGCTCAACAGTGACTACCCG

sina12345_0_2_13

Image 01

Genome: ACGCTGCGGACGATGGTCCGTTACACTCGCAAT

sina12345_0_2_12

Image 01

Genome: ATCGCGAGATACCCCCTCCCTTGCTTGAGA

sina12345_0_2_10

Image 01

Genome: GTGGTGAGACTGAAGTCCTCCTCGCACTTGCTG

sina12345_0_2_3

Image 01

Genome: CTAAGCACTAGTTTGGCCCGCAGCACTGTGACC