header

genetic-algorithms.com

 

Inspect sina12345_0_2_12

Parents

Mother

Image 01

sina12345_0_1_27

Genome: ATCGCGATATACCCCTTCCCTTGATTGAGA

Father

Image 01

sina12345_0_1_6

Genome: TAATATTGGATGGCCCGCACTTGCCGTTAGTCG

sina12345_0_2_12

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 2
  • Total Fitness: 8
  • No. Votes: 1
  • Avg. Fitness 8
  • Created: 05/19/2019
  • Genome: ATCGCGAGATACCCCCTCCCTTGCTTGAGA
  • Function:

    band pass(product(numbers('rep'), numbers('xyy')) if product(numbers('rep'), numbers('xyy')) if numbers('xyy') > numbers('rep') else numbers('xry') > numbers('rep') else sin(numbers('xry') if numbers('rep') > numbers('xyy') else product(numbers('rep'), numbers('xyy'))))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_3_0

Image 01

Genome: GATATCGCCGCGCCATCCTGGGTTAACACTAGA

sina12345_0_3_3

Image 01

Genome: ATAGCGAGATACCCCCTCCCTTGCTTCTGA

sina12345_0_3_5

Image 01

Genome: TTAATCGAGATATATTCCCTCCCTTGCTTGCGA

sina12345_0_3_8

Image 01

Genome: ATTTACCGGATTTCCTTCTCTGTGAGGAGA

sina12345_0_3_15

Image 01

Genome: GGAATCACCGCGCCATCCTGGGTTAACATGAGA

sina12345_0_3_25

Image 01

Genome: CTGATCGCGAGGTACCCCCTCCCTTGCTACTTA

sina12345_0_3_12

Image 01

Genome: ACCAGTCCGAGATACCCCCTCCCTTGCAGGGCC