header

genetic-algorithms.com

 

Inspect sina12345_0_1_27

Parents

sina12345_0_1_27 has no parents. It was generated at random.

sina12345_0_1_27

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 1
  • Total Fitness: 5
  • No. Votes: 1
  • Avg. Fitness 5
  • Created: 05/19/2019
  • Genome: ATCGCGATATACCCCTTCCCTTGATTGAGA
  • Function:

    band pass(numbers("xxr") if numbers('xyy') > product(numbers('rep'), numbers('xyy')) else numbers('rep') if logn(numbers('xyy') if numbers('rep') > product(numbers('rep'), numbers('xyy')) else numbers("xxr")) > product(numbers('rep'), numbers('xyy')) else numbers('rep'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_2_12

Image 01

Genome: ATCGCGAGATACCCCCTCCCTTGCTTGAGA

sina12345_0_2_11

Image 01

Genome: GTCGCGATATACCAATATTGCCCTGTGAGA

sina12345_0_2_26

Image 01

Genome: TTCCTGCGGACGAGCTAATATTCCACTCGCAAT

sina12345_0_2_2

Image 01

Genome: GGGGCACTGGTGCACCCCTTCCCTTCATTAAGG