header

genetic-algorithms.com

 

Inspect sina12345_0_3_0

Parents

Mother

Image 01

sina12345_0_2_12

Genome: ATCGCGAGATACCCCCTCCCTTGCTTGAGA

Father

Image 01

sina12345_0_2_24

Genome: CATCGCGCGCCATCCTGGGTTAACACTGTTGGG

sina12345_0_3_0

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 3
  • Total Fitness: 6
  • No. Votes: 1
  • Avg. Fitness 6
  • Created: 05/19/2019
  • Genome: GATATCGCCGCGCCATCCTGGGTTAACACTAGA
  • Function:

    band pass(numbers('yxr') if product(numbers('yxr') if numbers("xxy") > numbers('xyy') else numbers('rrr'), numbers('yxr')) > product(numbers('yxr') if numbers("xxy") > numbers('xyy') else numbers('rrr'), numbers('yxr')) if numbers('yxr') if numbers('rrr') > numbers("xxy") else numbers('xyy') > numbers('yxr') else numbers('rrr') else numbers('yxr') if numbers("xxy") > numbers('xyy') else numbers('rrr')) if numbers('rrr') if numbers('yxr') > numbers("xxy") if numbers('yxr') > numbers('rrr') else numbers('xyy') else product(numbers('yxr') if numbers('rrr') > numbers('xyy') else numbers("xxy"), numbers('yxr')) if numbers('yxr') > product(numbers('yxr') if numbers("xxy") > numbers('rrr') else numbers('xyy'), numbers('yxr')) else numbers('xyy') if numbers('yxr') > numbers('rrr') else numbers("xxy") > product(numbers('xyy') if numbers("xxy") > numbers('yxr') else numbers('rrr'), numbers('yxr')) else numbers('rrr') if numbers('rrr') if numbers('yxr') > numbers('xyy') else numbers("xxy") > numbers('yxr') else product(numbers('yxr') if numbers('rrr') > numbers('xyy') else numbers("xxy"), numbers('yxr'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_4_5

Image 01

Genome: AGTAGACCTGTGTTCGCATCTCTGACGACA

sina12345_0_4_4

Image 01

Genome: ACCAACCTGCGGGTTTCCGGTGAAAACAGGATC

sina12345_0_4_3

Image 01

Genome: TATTCCAAACCGCAGATTTCCACTGAAAACAGCATC