header

genetic-algorithms.com

 

Inspect sina12345_0_3_3

Parents

Mother

Image 01

sina12345_0_2_12

Genome: ATCGCGAGATACCCCCTCCCTTGCTTGAGA

Father

Image 01

sina12345_0_2_5

Genome: CGCACTAGATTGGCGGTTCACACTGTGTCC

sina12345_0_3_3

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 3
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 05/19/2019
  • Genome: ATAGCGAGATACCCCCTCCCTTGCTTCTGA
  • Function:

    logn(product(numbers('rep'), numbers('xyy')) if numbers('rep') > numbers('rep') if numbers('xry') > numbers('xyy') else product(numbers('rep'), numbers('xyy')) else sin(product(numbers('rep'), numbers('xyy')) if numbers('xry') > numbers('rep') else numbers('xyy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_3_3 has no children. Either it's in the last generation of its population or it was unsuccessful in the ruthless process of natural selection!