header

genetic-algorithms.com

 

Inspect sina12345_0_3_5

Parents

Mother

Image 01

sina12345_0_2_12

Genome: ATCGCGAGATACCCCCTCCCTTGCTTGAGA

Father

Image 01

sina12345_0_2_26

Genome: TTCCTGCGGACGAGCTAATATTCCACTCGCAAT

sina12345_0_3_5

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 3
  • Total Fitness: 7
  • No. Votes: 1
  • Avg. Fitness 7
  • Created: 05/19/2019
  • Genome: TTAATCGAGATATATTCCCTCCCTTGCTTGCGA
  • Function:

    logn(numbers('epe') if numbers('xry') > numbers('xyy') else numbers('rep') if numbers('xyy') > numbers('xry') else numbers('rep')) if numbers('rep') if logn(numbers('xry') if numbers('xyy') > numbers('rep') else numbers('epe') if numbers('xry') > numbers('xyy') else numbers('rep')) > numbers('xyy') if numbers('xry') > numbers('rep') else numbers('epe') if numbers('rep') > numbers('xyy') else numbers('xry') else numbers('rep') if numbers('xyy') > numbers('xry') else numbers('epe') > band pass(numbers('xyy') if numbers('xry') > numbers('rep') else numbers('epe') if numbers('xry') > numbers('rep') else numbers('xyy') if logn(numbers('xyy') if numbers('rep') > numbers('xry') else numbers('xyy') if numbers('rep') > numbers('epe') else numbers('xry')) > numbers('xry') if numbers('epe') > numbers('xyy') else numbers('rep') else numbers('rep')) else numbers('rep') if numbers('xyy') > numbers('rep') if numbers('xry') > numbers('xyy') else numbers('epe') else numbers('xry')

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_4_23

Image 01

Genome: TGTCTGCTTCTATATTCCTTGCCTTGCTTGCGA

sina12345_0_4_8

Image 01

Genome: TTAATCGAGATATATTACCTCCCCTGCTTGAGA

sina12345_0_4_22

Image 01

Genome: TATCGGGGGGCAGACGGCGACCACTCTGTTGGG

sina12345_0_4_2

Image 01

Genome: GGCACCAGTACGAGATACCAGCTGCATTGCTCGCGC