header

genetic-algorithms.com

 

Inspect sina12345_0_7_6

Parents

Mother

Image 01

sina12345_0_6_11

Genome: GAAGCATGCCAGTGGACGGGTTCAGCCTGAACG

Father

Image 01

sina12345_0_6_12

Genome: GAAGGACCGGACTGATATTACCTCCCCTAAGGC

sina12345_0_7_6

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 7
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 05/19/2019
  • Genome: TACGAAGCATGCCAGCGGACGGATTCAGCCTGAACG
  • Function:

    minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy')) if exp(numbers('yxy'), numbers("yxx")) > minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy')) if numbers('yxy') > numbers('yxy') if exp(numbers('yxy'), numbers("yxx")) > numbers("yxx") else minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy')) else exp(numbers('yxy'), numbers("yxx")) else minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy')) if exp(numbers('yxy'), numbers("yxx")) > numbers("yxx") else numbers('yxy') if numbers('yxy') if minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy')) > exp(numbers('yxy'), numbers("yxx")) else numbers("yxx") > minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy')) if numbers('yxy') > exp(numbers('yxy'), numbers("yxx")) else minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy')) if exp(numbers('yxy'), numbers("yxx")) > numbers("yxx") else numbers('yxy') else minus(exp(numbers('yxy'), numbers("yxx")), numbers('yxy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_8_26

Image 01

Genome: AAGGGCTCACTTGAACTTGTGTGTGACTCAGCCTAC

sina12345_0_8_16

Image 01

Genome: CGTAGCGTTGGTCTCGATAGAGATATTAATACT

sina12345_0_8_9

Image 01

Genome: TTCTACTGGTGAACGGACCACTCTTTGTCTGTACGA