header

genetic-algorithms.com

 

Inspect sina12345_0_8_9

Parents

Mother

Image 01

sina12345_0_7_21

Genome: GACTGGTGACCGGACCACTCCTTCTCTGTTCTA

Father

Image 01

sina12345_0_7_6

Genome: TACGAAGCATGCCAGCGGACGGATTCAGCCTGAACG

sina12345_0_8_9

Image 01

  • Creator: sina12345
  • Population: 0
  • Generation: 8
  • Total Fitness: 34
  • No. Votes: 4
  • Avg. Fitness 8.5
  • Created: 05/19/2019
  • Genome: TTCTACTGGTGAACGGACCACTCTTTGTCTGTACGA
  • Function:

    100 *(numbers('xyy') if numbers('epe') > numbers('xyy') else numbers("xxy")) if numbers("xxy") if 100 *(numbers("xxy") if numbers('xyy') > numbers('epe') else numbers('xyy')) > numbers("xxy") if 100 *(numbers('xyy') if numbers('xyy') > numbers("xxy") else numbers('epe')) > numbers('xyy') else numbers('xyy') if numbers('epe') > numbers("xxy") else numbers('xyy') else numbers("xxy") if numbers('xyy') > numbers('epe') else numbers('xyy') > numbers('xyy') if numbers("xxy") > 100 *(numbers('epe') if numbers('xyy') > numbers("xxy") else numbers('xyy')) else numbers('xyy') if numbers('epe') > numbers('xyy') else numbers("xxy") else numbers('xyy') if numbers('epe') > numbers("xxy") else numbers('xyy') if numbers("xxy") if 100 *(numbers('xyy') if numbers("xxy") > numbers('xyy') else numbers('epe')) > numbers('xyy') if numbers("xxy") > numbers('epe') else numbers('xyy') else numbers('xyy') > 100 *(numbers('xyy') if numbers('xyy') > numbers("xxy") else numbers('epe')) else numbers('epe') if numbers("xxy") > numbers('xyy') else numbers('xyy') if numbers("xxy") > numbers("xxy") if numbers('xyy') if numbers('epe') > numbers('xyy') else numbers("xxy") > 100 *(numbers('xyy') if numbers('epe') > numbers("xxy") else numbers('xyy')) else numbers('xyy') else 100 *(numbers('epe') if numbers("xxy") > numbers('xyy') else numbers('xyy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_9_15

Image 01

Genome: GGCTACTACTGGTGAACGAAAAAGTCCTCCTCTGTTCTA

sina12345_0_9_10

Image 01

Genome: GGCTTGGACTGGTGCCCGGACAACTCCATGTCTGTACGA

sina12345_0_9_4

Image 01

Genome: TTCCAAGTGTGAACGGACCACTCTTTGTCTGTACGA

sina12345_0_9_7

Image 01

Genome: CGTAGCGTTCGGCTCGATAGAGATTTGTCTGCT

sina12345_0_9_3

Image 01

Genome: GAACAGGTTCACGAAACACTTGTGCGCTCGGTAGGG