• Creator: guest1650
• Population: 0
• Generation: 2
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/16/2020
• Genome: GCAAGCCCCTGTAGCACCACTCCTTACAGTGGG
• Function:

  product(10 *(numbers('xyy')) if numbers('xyy') > cos(10 *(numbers('xyy'))) else numbers('xyy'), cos(10 *(numbers('xyy')))) if cos(10 *(numbers('xyy'))) > cos(product(cos(10 *(numbers('xyy'))) if numbers('xyy') > 10 *(numbers('xyy')) else numbers('xyy'), cos(10 *(numbers('xyy'))))) else numbers('xyy') if numbers('xyy') > cos(10 *(numbers('xyy'))) else 10 *(numbers('xyy'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.