• Creator: guest1650
• Population: 0
• Generation: 1
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/16/2020
• Genome: GGGTAAGGTAGCACCCCCCTTCCACAGTAG
• Function:

  10 *(numbers('yyx')) if cos(10 *(numbers('yyx'))) > numbers('rrr') else numbers('yyx') if 10 *(numbers('yyx')) > cos(10 *(numbers('yyx'))) if 10 *(numbers('yyx')) if cos(10 *(numbers('yyx'))) > numbers('yyx') else numbers('rrr') > 10 *(numbers('yyx')) else numbers('yyx') else cos(10 *(numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.