• Creator: guest1650
• Population: 0
• Generation: 2
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/16/2020
• Genome: AGAGGGGAATGTAGCACCCCCGTCTGCGCCCCG
• Function:

  sin(cos(10 *(numbers('yyx'))) if numbers('yyx') > 10 *(numbers('yyx')) else numbers('rep') if 10 *(numbers('yyx')) > numbers('yyx') if 10 *(numbers('yyx')) > cos(10 *(numbers('yyx'))) else cos(10 *(numbers('yyx'))) if numbers('yyx') > numbers('rep') else 10 *(numbers('yyx')) else cos(10 *(numbers('yyx'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.