• Creator: sina12345
• Population: 1
• Generation: 6
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: CAACCGAGGCAAAAGCAACCTTACATACGA
• Function:

  sum(divide(tan(sum(invert(numbers("xxx")), numbers("xxx"))), sum(invert(numbers("xxx")), numbers("xxx"))), tan(sum(invert(numbers("xxx")), numbers("xxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.