• Creator: sina12345
• Population: 1
• Generation: 5
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: CAACCGAGGCAAAACTCTACTTTCATACGA
• Function:

  sum(divide(tan(sum(square(numbers('xyy')), numbers('xyy'))), sum(square(numbers('xyy')), numbers('xyy'))), tan(sum(square(numbers('xyy')), numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.