• Creator: sina12345
• Population: 1
• Generation: 6
• Total Fitness: 6
• No. Votes: 1
• Avg. Fitness 6
• Created: 05/19/2019
• Genome: ACACAGCCGAGGCAGAACTGTACTTTCATACAA
• Function:

  gradient[2](minus(divide(tan(minus(square(numbers('ryy')), numbers('ryy'))), minus(square(numbers('ryy')), numbers('ryy'))), tan(minus(square(numbers('ryy')), numbers('ryy')))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.