• Creator: guest73
• Population: 0
• Generation: 0
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: GAGCACCGTAGAACTACCGTAACAAACAGT
• Function:

  sum(log(sin(2 *(numbers('yyx'))), 2 *(numbers('yyx'))), sin(2 *(numbers('yyx')))) if log(sin(2 *(numbers('yyx'))), 2 *(numbers('yyx'))) > 2 *(numbers('yyx')) else sin(2 *(numbers('yyx')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.