• Creator: guest73
• Population: 0
• Generation: 1
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: GAGGACCGTAGGACTACCGTAACAAACAGT
• Function:

  log(tan(2 *(numbers('yyx'))), 2 *(numbers('yyx'))) if tan(2 *(numbers('yyx'))) > 2 *(numbers('yyx')) else tan(2 *(numbers('yyx'))) if log(tan(2 *(numbers('yyx'))), 2 *(numbers('yyx'))) > numbers('yyx') else 2 *(numbers('yyx'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.