• Creator: guest73
• Population: 0
• Generation: 2
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: GAGGACCCTAGGACTCAGCCCTTGTCAAGT
• Function:

  2 *(numbers("xyx")) if divide(tan(2 *(numbers("xyx"))), 2 *(numbers("xyx"))) > divide(tan(2 *(numbers("xyx"))), 2 *(numbers("xyx"))) if tan(2 *(numbers("xyx"))) > numbers("xyx") else 2 *(numbers("xyx")) else tan(2 *(numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.