• Creator: guest73
• Population: 0
• Generation: 2
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: GAGGACCCTAGGACTCAGCCCTTGTCAAGT
• Function:

  tan(2 *(numbers("xyx"))) if tan(2 *(numbers("xyx"))) if 2 *(numbers("xyx")) > divide(tan(2 *(numbers("xyx"))), 2 *(numbers("xyx"))) else numbers("xyx") > divide(tan(2 *(numbers("xyx"))), 2 *(numbers("xyx"))) else 2 *(numbers("xyx"))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.