• Creator: guest73
• Population: 0
• Generation: 4
• Total Fitness: 4
• No. Votes: 1
• Avg. Fitness 4
• Created: 05/19/2019
• Genome: TTCCCCCCAACCCTGACTACCCACGCGATGCAG
• Function:

  product(product(10 *(mean(2 *(numbers('yyx')), numbers('yyx'))), mean(2 *(numbers('yyx')), numbers('yyx'))), 10 *(mean(2 *(numbers('yyx')), numbers('yyx')))) if 10 *(mean(2 *(numbers('yyx')), numbers('yyx'))) > product(10 *(mean(2 *(numbers('yyx')), numbers('yyx'))), mean(2 *(numbers('yyx')), numbers('yyx'))) else mean(2 *(numbers('yyx')), numbers('yyx'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.