• Creator: guest73
• Population: 0
• Generation: 3
• Total Fitness: 5
• No. Votes: 1
• Avg. Fitness 5
• Created: 05/19/2019
• Genome: TTCCCCCCAAACCTGACTAGCCACGCGATGCAG
• Function:

  product(square(mean(2 *(numbers('xry')), numbers('xry'))), mean(2 *(numbers('xry')), numbers('xry'))) if square(mean(2 *(numbers('xry')), numbers('xry'))) > product(product(square(mean(2 *(numbers('xry')), numbers('xry'))), mean(2 *(numbers('xry')), numbers('xry'))), square(mean(2 *(numbers('xry')), numbers('xry')))) else mean(2 *(numbers('xry')), numbers('xry'))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.