header

genetic-algorithms.com

 

Inspect sina12345_global_0_1_253

Parents

Mother

Image 01

global_global_0_0_151

Genome: TTAGTCCTCATGCCTCAGCGATGGGGACCG

Father

Image 01

global_global_0_0_83

Genome: CGTGTCGGCGAACCCCTGGGTCTGCGAGAA

sina12345_global_0_1_253

Image 01

  • Creator: sina12345
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 2
  • No. Votes: 1
  • Avg. Fitness 2
  • Created: 05/19/2019
  • Genome: TTAGTCCTCATGCCCCTGGGTCTGCGAGAG
  • Function:

    min(sqrt(product(numbers('epe'), numbers('ryy'))), product(numbers('epe'), numbers('ryy'))) if sqrt(product(numbers('epe'), numbers('ryy'))) > min(sqrt(product(numbers('epe'), numbers('ryy'))), product(numbers('epe'), numbers('ryy'))) if sqrt(product(numbers('epe'), numbers('ryy'))) > numbers('epe') else product(numbers('epe'), numbers('ryy')) else product(numbers('epe'), numbers('ryy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_2_213

Image 01

Genome: CGATTAGTCCTCATGCCCCCGGGTCTGCGAAAG