header

genetic-algorithms.com

 

Inspect global_global_0_0_83

Parents

global_global_0_0_83 has no parents. It was generated at random.

global_global_0_0_83

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 42
  • No. Votes: 5
  • Avg. Fitness 8.4
  • Created: 05/19/2019
  • Genome: CGTGTCGGCGAACCCCTGGGTCTGCGAGAA
  • Function:

    log(numbers('ryy') if numbers('epe') > numbers('ryy') if numbers('epe') > numbers('epe') else product(numbers('epe'), numbers('ryy')) else product(numbers('epe'), numbers('ryy')) if product(numbers('epe'), numbers('ryy')) > numbers('epe') else product(numbers('epe'), numbers('ryy')) if numbers('epe') > numbers('epe') else numbers('ryy'), numbers('epe') if numbers('ryy') if product(numbers('epe'), numbers('ryy')) > numbers('epe') else numbers('epe') > product(numbers('epe'), numbers('ryy')) else numbers('ryy'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest4634_0_1_350

Image 01

Genome: CGAGTTTGCGAACCCCTGGGTCTGCGTGAACGA

guest195_0_1_331

Image 01

Genome: GTTGGTGTCGGCGCACCCTAATGTCGCTGATAAAAA

sina12345_0_1_240

Image 01

Genome: AGGAGTGTCGGCGAGAAGCGCAGCCTGAGAGAA

sina12345_0_1_171

Image 01

Genome: CATGTCGGCGAACCGGGGCCGGTGCTAGAA

guest30_0_1_99

Image 01

Genome: CGTGTCGGCGAACCCCTGGTTGTGCGAGAA

guest195_0_1_327

Image 01

Genome: TATGCGCTTCTGAATATGGCCGCTGTGCGTCAG

guest195_0_1_326

Image 01

Genome: CGTACCGCAACGTATGTCAAGCAACTGTTACAG

guest195_0_1_303

Image 01

Genome: CCATTAGCACACTTTAGGGCTTGTGGATGT

sina12345_0_1_253

Image 01

Genome: TTAGTCCTCATGCCCCTGGGTCTGCGAGAG

sina12345_0_1_208

Image 01

Genome: TATGTCGGCGAACCCAACGTTCAATCTGGG

guest52_0_1_114

Image 01

Genome: GTGATGCAATACGCGGAATGCCGATACCCCACA