header

genetic-algorithms.com

 

Inspect guest75_global_0_1_264

Parents

Mother

Image 01

global_global_0_0_86

Genome: CTCCTAATCTCGTTATACTCTGTGTTACAG

Father

Image 01

global_global_0_0_148

Genome: ACATGCCCAGTTTGGGCAGTGTATTTGTGC

guest75_global_0_1_264

Image 01

  • Creator: guest75
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 5
  • No. Votes: 2
  • Avg. Fitness 2.5
  • Created: 05/19/2019
  • Genome: CTACTCTTAATCTCGTTAGCAGAGTATTTACAG
  • Function:

    max(min(numbers("yyy") if band pass(numbers("yxx") if numbers("xyx") > numbers("yyy") else numbers("per") if numbers("yxx") > numbers("xyx") else numbers("yyy")) > numbers("yxx") if numbers("xyx") > numbers("yyy") else numbers("yxx") if numbers("per") > numbers("xyx") else numbers("yyy") else numbers("xyx") if numbers("yxx") > numbers("yyy") else numbers("per"), band pass(numbers("xyx") if numbers("yxx") > numbers("yyy") else numbers("yxx") if numbers("yyy") > numbers("xyx") else numbers("per"))), numbers("xyx") if numbers("yyy") > numbers("yxx") else numbers("xyx") if numbers("yxx") > numbers("yyy") else numbers("per") if band pass(numbers("xyx") if numbers("yyy") > numbers("yxx") else numbers("per") if numbers("yxx") > numbers("yyy") else numbers("xyx")) > numbers("yxx") if numbers("yyy") > numbers("xyx") else numbers("per") else numbers("yyy"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest200_0_2_230

Image 01

Genome: CTACTCTTAATCTCGTTAGCAACAAACGCACAG

guest203_0_2_243

Image 01

Genome: TTTTGGTTAATCTCGTCCGTCGGCCACAGACAG

guest195_0_2_171

Image 01

Genome: AGACTAGTTGTCCCGTTAGACGAGGTGACC