header

genetic-algorithms.com

 

Inspect global_global_0_0_86

Parents

global_global_0_0_86 has no parents. It was generated at random.

global_global_0_0_86

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 30
  • No. Votes: 3
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: CTCCTAATCTCGTTATACTCTGTGTTACAG
  • Function:

    min(max(band pass(numbers('xyy') if numbers("xxy") > numbers("per") if numbers("xxy") > numbers('xyy') else numbers('epe') else numbers('epe')), numbers('epe') if numbers('xyy') > numbers("xxy") else numbers('xyy') if numbers('epe') > numbers("xxy") else numbers("per")), band pass(numbers("xxy") if numbers('xyy') > numbers('epe') else numbers("per") if numbers('xyy') > numbers("xxy") else numbers('epe')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest75_0_1_264

Image 01

Genome: CTACTCTTAATCTCGTTAGCAGAGTATTTACAG

sina12345_0_1_141

Image 01

Genome: GATCTCATAATCGCGTTCTAAGGTGTGTTACAG

guest30_0_1_47

Image 01

Genome: ATTCTCCGTTTAAGTCTCGGTACCCTGTTCCAG

guest75_0_1_257

Image 01

Genome: TACAGGCCCTGCACTTTATTCTCTGTGTTCAGC

sina12345_0_1_172

Image 01

Genome: ACACTAGTAGCCCCCTACCTTGCTGGTTGT

sina12345_0_1_163

Image 01

Genome: GGATTCACAATCTCGTAAGCCCGTGCAGTACGG

guest30_0_1_90

Image 01

Genome: ACCGTAAGATCCGAGTAGGGTGTCTTAGAC

guest30_0_1_51

Image 01

Genome: CCAGGCCTCTACGTGCTCTCGATAAGATCCATT