header

genetic-algorithms.com

 

Inspect guest75_global_0_1_267

Parents

Mother

Image 01

global_global_0_0_192

Genome: ACGTAGAAGTTTGAGCAGACGGATATTCCT

Father

Image 01

Genome:

guest75_global_0_1_267

Image 01

  • Creator: guest75
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 6
  • No. Votes: 2
  • Avg. Fitness 3
  • Created: 05/19/2019
  • Genome: ACGTAGAAGTACGAGCAGACCGATATTTCT
  • Function:

    100 *(invert(numbers("xyx") if numbers('rrr') if numbers('yyx') > numbers("xyx") else numbers("yxx") > numbers('yyx') else numbers("yxx")) if numbers("xyx") > numbers('yyx') if numbers("xyx") > numbers('rrr') else numbers("yxx") else numbers('rrr') if numbers("xyx") > numbers("yxx") else numbers('yyx') if numbers("xyx") > numbers('yyx') else numbers("yxx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest200_0_2_222

Image 01

Genome: TGTACGTAGAAGTACCCTCCGTAAACATTTTCTACT

guest195_0_2_161

Image 01

Genome: CATACGTAGAAGTACGAGCAGGCGAGATCTTCT

global_0_2_10

Image 01

Genome: GGAAGAAAGACCGGCAGGTTGTTCATCAGT