header

genetic-algorithms.com

 

Inspect global_global_0_0_43

Parents

global_global_0_0_43 has no parents. It was generated at random.

global_global_0_0_43

Image 01

  • Creator: global
  • Population: 0 (Global)
  • Generation: 0
  • Total Fitness: 5
  • No. Votes: 3
  • Avg. Fitness 1.7
  • Created: 05/19/2019
  • Genome: GACCGGAGTGCCAAGCTGGGCTGTTGGTGG
  • Function:

    exp(gradient[1](invert(numbers('epe')) if numbers('epe') > numbers('xry') else numbers('ryy')), numbers('xry') if numbers('epe') > invert(numbers('epe')) else numbers('ryy')) if gradient[1](numbers('epe') if numbers('xry') > invert(numbers('epe')) else numbers('ryy')) > numbers('xry') if numbers('ryy') > invert(numbers('epe')) else numbers('epe') else invert(numbers('epe'))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

sina12345_0_1_157

Image 01

Genome: TAGGTCCGGAGAAGATTCCCATTCGAGCGATGG

guest30_0_1_72

Image 01

Genome: GACCGGAGTGCCAAGCTGGGCTGTTGGTCG

camrobjones_0_1_23

Image 01

Genome: ATGGACCGGAGTGTCGAGCTGGGCTGTTGGAGC

sina12345_0_1_144

Image 01

Genome: AACACGTAGAATTTTGAGCAGACGGATATTTCT