header

genetic-algorithms.com

 

Inspect sina12345_global_0_1_144

Parents

Mother

Image 01

global_global_0_0_192

Genome: ACGTAGAAGTTTGAGCAGACGGATATTCCT

Father

Image 01

global_global_0_0_43

Genome: GACCGGAGTGCCAAGCTGGGCTGTTGGTGG

sina12345_global_0_1_144

Image 01

  • Creator: sina12345
  • Population: 0 (Global)
  • Generation: 1
  • Total Fitness: 17
  • No. Votes: 3
  • Avg. Fitness 5.7
  • Created: 05/19/2019
  • Genome: AACACGTAGAATTTTGAGCAGACGGATATTTCT
  • Function:

    square(100 *(noise(numbers("yxx") if numbers('rrr') > numbers("xyx") else numbers('yxy') if numbers("yxx") > numbers('yxy') else numbers("xyx")) if numbers("xyx") if numbers("yxx") > numbers('rrr') else numbers('yxy') > numbers("xyx") else numbers('yxy') if numbers('rrr') > numbers("xyx") else numbers("yxx") if numbers("yxx") > numbers("xyx") else numbers('yxy')))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest195_0_2_190

Image 01

Genome: AACACGTAGGATTTAGAGTAGAAGGATATTTAT

guest146_0_2_155

Image 01

Genome: AACAGGTAGAATTTAGAGTAGAAGGATATTTCT

guest75_0_2_139

Image 01

Genome: GGATATGCATACATCAAATGTCAGACGTACGAC

sina12345_0_2_97

Image 01

Genome: ATGTGGCGAGCCGCCCCCGTAGGCGAGAGA

sina12345_0_2_88

Image 01

Genome: CGTGTAGACGAACCCCTGGGTCTGGATACA