• Creator: guest79
• Population: 0
• Generation: 1
• Total Fitness: 3
• No. Votes: 1
• Avg. Fitness 3
• Created: 05/19/2019
• Genome: CGACCTAAGATCACGCGAGCGCGGCTAGGG
• Function:

  mod(divide(invert(band pass(100 *(numbers("xxr")))), band pass(100 *(numbers("xxr")))), invert(band pass(100 *(numbers("xxr")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.