• Creator: guest79
• Population: 0
• Generation: 2
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: ATACGATCTATGACTCGCCATCAGTATTTTGCA
• Function:

  logn(mod(2 *(round(numbers("yxx"), numbers("xyx"))) if round(numbers("yxx"), numbers("xyx")) > numbers("yxx") else sqrt(2 *(round(numbers("yxx"), numbers("xyx")))), sqrt(2 *(round(numbers("yxx"), numbers("xyx"))))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.