• Creator: guest79
• Population: 0
• Generation: 1
• Total Fitness: 20
• No. Votes: 2
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: ATGATTTAAGCTACTAGCCATTTCTGGCTAGCA
• Function:

  sqrt(gradient[0](cos(numbers("yxx")) if 2 *(cos(numbers("yxx"))) > numbers('rep') else numbers("yxx") if cos(numbers("yxx")) > numbers("yxx") else 2 *(cos(numbers("yxx")))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.