header

genetic-algorithms.com

 

Inspect guest79_0_1_19

Parents

Mother

Image 01

guest79_0_0_27

Genome: ATTTAAGCTACTAGCCATCAGTATTTTGCA

Father

Image 01

guest79_0_0_29

Genome: CGTTAAAAAGCGCCCCCCTTCTGGCAGTTC

guest79_0_1_19

Image 01

  • Creator: guest79
  • Population: 0
  • Generation: 1
  • Total Fitness: 20
  • No. Votes: 2
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: ATGATTTAAGCTACTAGCCATTTCTGGCTAGCA
  • Function:

    sqrt(gradient[0](cos(numbers("yxx")) if 2 *(cos(numbers("yxx"))) if numbers('rep') > numbers("yxx") else cos(numbers("yxx")) > 2 *(cos(numbers("yxx"))) else numbers("yxx")))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest79_0_2_18

Image 01

Genome: GTCTTTTAAGCTACTGGGACGAACAGGAAG