• Creator: guest79
• Population: 0
• Generation: 0
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: ATTTAAGCTACTAGCCATCAGTATTTTGCA
• Function:

  gradient[0](cos(numbers("yxx")) if 2 *(cos(numbers("yxx"))) > numbers("yxx") else numbers("xyx") if numbers("yxx") > cos(numbers("yxx")) else 2 *(cos(numbers("yxx"))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.