header

genetic-algorithms.com

 

Inspect guest79_0_1_26

Parents

Mother

Image 01

guest79_0_0_0

Genome: CGTTGAGCTAGGTGTCATGACAGGCCGAGT

Father

Image 01

guest79_0_0_19

Genome: TGCTGGACCAGTGGAGAGCACCCATCGTAC

guest79_0_1_26

Image 01

  • Creator: guest79
  • Population: 0
  • Generation: 1
  • Total Fitness: 20
  • No. Votes: 2
  • Avg. Fitness 10
  • Created: 05/19/2019
  • Genome: TTTCGTTTAGCTACGTGAGAGTACCCATCGTGT
  • Function:

    100 *(numbers('yxy') if numbers("yyy") > numbers("xxy") else numbers("xyx")) if numbers("xxy") if 100 *(numbers('yxy') if numbers("xyx") > numbers("yyy") else numbers("xxy")) > numbers("yyy") if numbers("xxy") > numbers('yxy') else numbers("xyx") else numbers("xyx") > numbers("xxy") if 100 *(numbers("xxy") if numbers('yxy') > numbers("yyy") else numbers("xyx")) > numbers('yxy') if numbers("yyy") > numbers("xyx") else numbers("xxy") else numbers("xyx") if numbers("yyy") if numbers("xxy") > numbers("xyx") else numbers('yxy') > numbers("xyx") else 100 *(numbers("xyx") if numbers('yxy') > numbers("xxy") else numbers("yyy")) else log(numbers("xyx") if 100 *(numbers("xxy") if numbers("yyy") > numbers('yxy') else numbers("xyx")) > numbers('yxy') if numbers("xyx") > numbers("yyy") else numbers("xxy") else numbers("xxy") if numbers("xyx") > numbers("xyx") if numbers("xxy") > numbers("yyy") else numbers('yxy') else 100 *(numbers("xxy") if numbers("yyy") > numbers('yxy') else numbers("xyx")), 100 *(numbers('yxy') if numbers("xyx") > numbers("xxy") else numbers("yyy")) if numbers("xxy") > numbers("xyx") if numbers("yyy") > numbers("xxy") else numbers('yxy') else numbers("xyx"))

Import to Sandbox

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.

Children

guest79_0_2_21

Image 01

Genome: ACTTTTCGTTTAACTACGTGAGAGGAAAGCGTGTGT

guest79_0_2_0

Image 01

Genome: GCTCGTTTAGCGACGTGAGAGTACCCATCGTAT

guest79_0_2_24

Image 01

Genome: TTCTCGTTGACTCGCCATCAGTACCCATCA

guest79_0_2_15

Image 01

Genome: CTAGGCCGTCTAGCGACCAGAGACCTATTCTCT

guest79_0_2_13

Image 01

Genome: CGTCGTTTCGTTTAATGTCGGAATTTACAACTT

guest79_0_2_4

Image 01

Genome: CCCTCACTCGAGACGTGGGAGTGGTACCTC