• Creator: guest79
• Population: 0
• Generation: 2
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: TTCTCGTTGACTCGCCATCAGTACCCATCA
• Function:

  round(numbers("yxx"), numbers("xyx")) if numbers("xyx") > numbers("yxx") else 2 *(round(numbers("yxx"), numbers("xyx"))) if 2 *(round(numbers("yxx"), numbers("xyx"))) > round(numbers("yxx"), numbers("xyx")) else numbers("yxx") if round(numbers("yxx"), numbers("xyx")) > round(numbers("yxx"), numbers("xyx")) if 2 *(round(numbers("yxx"), numbers("xyx"))) > numbers("yxx") else numbers("xyx") else 2 *(round(numbers("yxx"), numbers("xyx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.