• Creator: guest90
• Population: 0
• Generation: 0
• Total Fitness: 8
• No. Votes: 1
• Avg. Fitness 8
• Created: 05/19/2019
• Genome: TCCAATTCAACAAAAGATCGTGGTAGATCA
• Function:

  numbers('ryy') if numbers("yxx") > abs(numbers("yxx")) else gradient[2](abs(numbers("yxx"))) if noise(numbers('ryy') if gradient[2](abs(numbers("yxx"))) > abs(numbers("yxx")) else numbers("yxx")) > abs(numbers("yxx")) else gradient[2](abs(numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.