• Creator: guest90
• Population: 0
• Generation: 1
• Total Fitness: 7
• No. Votes: 1
• Avg. Fitness 7
• Created: 05/19/2019
• Genome: TCCAATTCAACAAAAGATCCATGAAGATCA
• Function:

  noise(gradient[2](abs(numbers("yxx"))) if abs(numbers("yxx")) > numbers("yyy") else numbers("yxx")) if abs(numbers("yxx")) > numbers("yxx") if abs(numbers("yxx")) > gradient[2](abs(numbers("yxx"))) else numbers("yyy") else gradient[2](abs(numbers("yxx")))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.