• Creator: guest98
• Population: 0
• Generation: 1
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: ATCTTAGACAGCAGTCGCAGGGTGTACACT
• Function:

  band pass(numbers('xry') if gradient[1](numbers('xry')) if cos(gradient[1](numbers('xry'))) > numbers('xry') else numbers('yxr') > gradient[1](numbers('xry')) else cos(gradient[1](numbers('xry'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.