• Creator: guest98
• Population: 0
• Generation: 2
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: CGAATCTTAGACAGCAGTCCTAGGGTGTACGCT
• Function:

  mod(band pass(numbers('xyy') if cos(gradient[1](numbers('xyy'))) > numbers('yxr') if gradient[1](numbers('xyy')) > numbers('xyy') else cos(gradient[1](numbers('xyy'))) else gradient[1](numbers('xyy'))), numbers('xyy') if gradient[1](numbers('xyy')) if cos(gradient[1](numbers('xyy'))) > numbers('xyy') else numbers('yxr') > gradient[1](numbers('xyy')) else cos(gradient[1](numbers('xyy'))))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.