• Creator: guest98
• Population: 0
• Generation: 2
• Total Fitness: 10
• No. Votes: 1
• Avg. Fitness 10
• Created: 05/19/2019
• Genome: CGAATCTTAGACAGCAGTCCTAGGGTGTACGCT
• Function:

  mod(band pass(cos(gradient[1](numbers('xyy'))) if numbers('yxr') if gradient[1](numbers('xyy')) > cos(gradient[1](numbers('xyy'))) else numbers('xyy') > numbers('xyy') else gradient[1](numbers('xyy'))), gradient[1](numbers('xyy')) if numbers('yxr') > numbers('xyy') else cos(gradient[1](numbers('xyy'))) if cos(gradient[1](numbers('xyy'))) > numbers('xyy') else gradient[1](numbers('xyy')))

Not what you were expecting?

Some images will appear differently when resized as some of the functions which generate images are sensitive to the scale. We're working to improve this.